Stem-loop sequence ppt-MIR166g

AccessionMI0005910 (change log)
DescriptionPhyscomitrella patens miR166g stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention ppt-MIR166g
(5 sentences)

Stem-loop
   gu   ga      u     a    c     c a      ccc     c      g a  uac   u -  ucu 
5'   gcg  gguguu aggug aacu ugcug g ggaaug   ccugg ccgaag c ug   uuc c cc   u
     |||  |||||| ||||| |||| ||||| | ||||||   ||||| |||||| | ||   ||| | ||   c
3'   ugc  uuauag uuuac uuga gcgac c ccuuac   ggacc ggcuuc g ac   gag g gg   g
   -c   ac      c     a    c     u c      uuc     a      - a  uac   u u  uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr01: 18416230-18416375 [+]
intergenic
Database links

Mature sequence ppt-miR166g

Accession MIMAT0005043
Sequence

96 - 

ucggaccaggcuucauucccc

 - 116

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).