Stem-loop sequence ppt-MIR166f

AccessionMI0005909 (change log)
DescriptionPhyscomitrella patens miR166f stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention ppt-MIR166f
(5 sentences)

Stem-loop
   -a   -  ag  uacca   gu    u      a      cu  a        u    u  cu 
5'   uga cc  ca     gug  gcug gcuggg ggaaug  gc uggucuga gcuu ug  g
     ||| ||  ||     |||  |||| |||||| ||||||  || |||||||| |||| ||   
3'   acu gg  gu     uac  ugac cgacuc ccuuac  cg accaggcu cgaa ac  c
   ga   u  ca  ---ua   uc    u      c      uu  g        c    c  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr06: 13228484-13228606 [+]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR166f
ppt-MIR166cChr06: 13227780-13227902 [+]
ppt-MIR166dChr06: 13227958-13228085 [+]
ppt-MIR166fChr06: 13228484-13228606 [+]
Database links

Mature sequence ppt-miR166f

Accession MIMAT0005042
Sequence

74 - 

ucggaccaggcuucauucccc

 - 94

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).