Stem-loop sequence ppt-MIR166e

AccessionMI0005908 (change log)
DescriptionPhyscomitrella patens miR166e stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention ppt-MIR166e
(5 sentences)

Stem-loop
   aa   g  u   ga  u     c  -     u a      cc  a   a       uau   - ---u     uu 
5'   ugu cu uug  gu gugaa cu ugcug g ggaaug  gc ugg ccgaagc   gug c    ccauc  a
     ||| || |||  || ||||| || ||||| | ||||||  || ||| |||||||   ||| |    |||||  a
3'   gca gg agu  ua uacuu ga gcgac c ccuuac  cg acc ggcuuug   cau g    ggugg  c
   -g   -  u   gg  c     u  c     u c      uu  g   a       cau   a uuau     ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr14: 8707192-8707337 [+]
intergenic
Database links

Mature sequence ppt-miR166e

Accession MIMAT0005041
Sequence

96 - 

ucggaccaggcuucauucccc

 - 116

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).