Stem-loop sequence ppt-MIR166d

AccessionMI0005907 (change log)
DescriptionPhyscomitrella patens miR166d stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention ppt-MIR166d
(5 sentences)

Stem-loop
   cauauua     -         g c uu         uga    a          uuagc     u 
5'        gucau augcggcuu u c  ggggaauga   uugg ccgaaguuuu     guugg u
          ||||| ||||||||| | |  |||||||||   |||| ||||||||||     ||||| u
3'        uagua uacguugaa a g  ccccuuacu   gacc ggcuucgaaa     uaacc g
   --uaacg     g         g u cu         ucg    a          ----u     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr06: 13227958-13228085 [+]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR166d
ppt-MIR166cChr06: 13227780-13227902 [+]
ppt-MIR166dChr06: 13227958-13228085 [+]
ppt-MIR166fChr06: 13228484-13228606 [+]
Database links

Mature sequence ppt-miR166d

Accession MIMAT0005040
Sequence

82 - 

ucggaccaggcuucauucccc

 - 102

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).