Stem-loop sequence ppt-MIR166c

AccessionMI0005906 (change log)
DescriptionPhyscomitrella patens miR166c stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention ppt-MIR166c
(5 sentences)

Stem-loop
   acu   ug aa -   gg    ua   u        cc      a        g  -   cc 
5'    ugg  c  c aug  acuu  ucg ggggaaug  gucugg ccggagcu ug ugu  a
      |||  |  | |||  ||||  ||| ||||||||  |||||| |||||||| || |||  c
3'    auc  g  g uac  ugag  agc ccccuuac  cggacc ggcuucga ac acg  u
   --u   gu ac a   uu    gg   u        uu      a        a  u   uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr06: 13227780-13227902 [+]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR166c
ppt-MIR166cChr06: 13227780-13227902 [+]
ppt-MIR166dChr06: 13227958-13228085 [+]
ppt-MIR166fChr06: 13228484-13228606 [+]
Database links

Mature sequence ppt-miR166c

Accession MIMAT0005039
Sequence

77 - 

ucggaccaggcuucauucccc

 - 97

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).