Stem-loop sequence ppt-MIR160i

AccessionMI0005905 (change log)
DescriptionPhyscomitrella patens miR160i stem-loop
Gene family MIPF0000032; MIR160
Literature search

3 open access papers mention ppt-MIR160i
(9 sentences)

Stem-loop
   cguua  a -  aa       -u   g  -u  -  c          u      c       gcaug  aaa   u 
5'      gc c gg  uauggga  acu ga  cc gc uggcucccug augcca cugcgaa     cu   ggu u
        || | ||  |||||||  ||| ||  || || |||||||||| |||||| |||||||     ||   |||  
3'      cg g cc  augcccu  uga cu  gg cg acugagggac ugcggu gacguuu     gg   ccg u
   ----c  c a  -a       uc   a  cc  a  a          u      c       ----a  --a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr21: 10139826-10139964 [+]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR160i
ppt-MIR160hChr21: 10138798-10138933 [+]
ppt-MIR160dChr21: 10139128-10139227 [+]
ppt-MIR160iChr21: 10139826-10139964 [+]
Database links

Mature sequence ppt-miR160i

Accession MIMAT0005038
Sequence

30 - 

cgccuggcucccuguaugcca

 - 50

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).