Stem-loop sequence ppt-MIR160h

AccessionMI0005904 (change log)
DescriptionPhyscomitrella patens miR160h stem-loop
Gene family MIPF0000032; MIR160
Literature search

3 open access papers mention ppt-MIR160h
(9 sentences)

Stem-loop
   uuaguuc  -     g     -auc  a  c  c          ua     a   a   g    uu  a 
5'        ag caugg gagau    gg uc gc uggcuccuug  ugcca cug gaa cuug  ga c
          || ||||| |||||    || || || ||||||||||  ||||| ||| ||| ||||  || a
3'        uc guacc uucug    cc gg cg acugagggac  acggu gau cuu ggac  uu u
   --cacuu  a     g     guua  -  a  a          uc     c   a   a    cg  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr21: 10138798-10138933 [+]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR160h
ppt-MIR160hChr21: 10138798-10138933 [+]
ppt-MIR160dChr21: 10139128-10139227 [+]
ppt-MIR160iChr21: 10139826-10139964 [+]
Database links

Mature sequence ppt-miR160h

Accession MIMAT0005037
Sequence

29 - 

cgccuggcuccuuguaugcca

 - 49

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).