Stem-loop sequence ppt-MIR160g

AccessionMI0005903 (change log)
DescriptionPhyscomitrella patens miR160g stem-loop
Gene family MIPF0000032; MIR160
Literature search

3 open access papers mention ppt-MIR160g
(9 sentences)

Stem-loop
   cu    -     aa      --auau   ac   c               c  u   c a g    a   a 
5'   caug aaauc  ugggga      ugg  cug cuggcuccuuguaug ca cug g a cuug caa a
     |||| |||||  ||||||      |||  ||| ||||||||||||||| || ||| | | |||| ||| c
3'   guac uuuag  acccuu      gcc  gac gacugagggacguac gu gau c u ggac guu u
   -c    a     --      cugcau   -a   a               c  c   a a g    c   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr19: 13800321-13800458 [-]
intergenic
Database links

Mature sequence ppt-miR160g

Accession MIMAT0005036
Sequence

30 - 

ugccuggcuccuuguaugcca

 - 50

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).