Stem-loop sequence ppt-MIR160f

AccessionMI0005902 (change log)
DescriptionPhyscomitrella patens miR160f stem-loop
Gene family MIPF0000032; MIR160
Literature search

3 open access papers mention ppt-MIR160f
(9 sentences)

Stem-loop
   -guuca   u   ac  ug  ga uu  a   c           u      c   c g      u   a 
5'       ugg uga  gg  gg  g  gg cug cuggcucccug augcca cug g ggcuug caa a
         ||| |||  ||  ||  |  || ||| ||||||||||| |||||| ||| | |||||| ||| u
3'       gcc acu  cc  uc  u  cc gac gaccgagggac uacggu gau c ucggac guu g
   cccugg   u   --  gu  uc uu  a   a           c      c   a g      c   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr09: 9548423-9548560 [-]
intergenic
Database links

Mature sequence ppt-miR160f

Accession MIMAT0005035
Sequence

30 - 

ugccuggcucccuguaugcca

 - 50

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).