Stem-loop sequence ppt-MIR160e

AccessionMI0005901 (change log)
DescriptionPhyscomitrella patens miR160e stem-loop
Gene family MIPF0000032; MIR160
Literature search

3 open access papers mention ppt-MIR160e
(9 sentences)

Stem-loop
   --c  c    a  aau      -aacu  ca   c               c  c     a      g  aa 
5'    ug agaa uc   ggggga     gg  cug cuggcucccuguaug ca uugcg auuuug ca  a
      || |||| ||   ||||||     ||  ||| ||||||||||||||| || ||||| |||||| ||  c
3'    ac ucuu ag   ccuucu     cc  gac gacugagggacauac gu gaugc ugggac gu  u
   agu  -    -  -gc      acguu  -a   a               c  c     a      g  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr22: 7580013-7580150 [+]
intergenic
Database links

Mature sequence ppt-miR160e

Accession MIMAT0005034
Sequence

30 - 

ugccuggcucccuguaugcca

 - 50

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).