Stem-loop sequence dme-mir-1016

AccessionMI0005877 (change log)
DescriptionDrosophila melanogaster miR-1016 stem-loop
Stem-loop
   g       a      au    ---    ua 
5'  uaaguau gagagg  guga   uugg  a
    ||||||| ||||||  ||||   ||||   
3'  auucaua cucucu  cacu   aacc  a
   g       c      -c    uga    uu 
Get sequence
Deep sequencing
241 reads, 0 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 14233130-14233187 [-]
sense
FBtr0087573 ; opa1-like-RB; intron 6
FBtr0087574 ; opa1-like-RA; intron 7
Database links

Mature sequence dme-miR-1016-5p

Accession MIMAT0020908
Sequence

2 - 

uaaguauagagaggauguga

 - 21

Get sequence
Deep sequencing176 reads, 30 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-1016-3p

Accession MIMAT0005029
Previous IDsdme-miR-1016
Sequence

38 - 

uucaccucucuccauacuuag

 - 58

Get sequence
Deep sequencing63 reads, 17 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).