Stem-loop sequence dme-mir-1014

AccessionMI0005875 (change log)
DescriptionDrosophila melanogaster miR-1014 stem-loop
Stem-loop
   --   u         ag        cg   g   g 
5'   gua aauggaaau  auuuuaau  cag cgc u
     ||| |||||||||  ||||||||  ||| |||  
3'   cgu uuacuuuua  uaaaauua  guu gug c
   ga   -         cu        -a   g   a 
Get sequence
Deep sequencing
509 reads, 0 reads per million, 34 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 31753524-31753591 [-]
sense
FBtr0300915 ; salt-RB; intron 3
Database links

Mature sequence dme-miR-1014-5p

Accession MIMAT0020907
Sequence

2 - 

uauaauggaaauagauuuuaau

 - 23

Get sequence
Deep sequencing337 reads, 28 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-1014-3p

Accession MIMAT0005027
Previous IDsdme-miR-1014
Sequence

48 - 

aaaauucauuuucauuugcag

 - 68

Get sequence
Deep sequencing151 reads, 32 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).