Stem-loop sequence dme-mir-1011

AccessionMI0005872 (change log)
DescriptionDrosophila melanogaster miR-1011 stem-loop
Gene family MIPF0000969; mir-1011
Literature search

1 open access papers mention dme-mir-1011
(1 sentences)

Stem-loop
   --      -u          g    ua 
5'   gugagu  uuugagccag aaua  g
     ||||||  |||||||||| ||||  u
3'   cgcucg  aaacuugguu uuau  u
   ga      cu          a    uc 
Get sequence
Deep sequencing
169 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 20853305-20853358 [-]
sense
FBtr0299719 ; Ir93a-RB; intron 2
FBtr0299720 ; Ir93a-RC; intron 4
FBtr0299718 ; Ir93a-RA; intron 7
Database links

Mature sequence dme-miR-1011-3p

Accession MIMAT0005024
Previous IDsdme-miR-1011
Sequence

32 - 

uuauugguucaaaucgcucgcag

 - 54

Get sequence
Deep sequencing168 reads, 29 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).