Stem-loop sequence dme-mir-1009

AccessionMI0005870 (change log)
DescriptionDrosophila melanogaster miR-1009 stem-loop
Literature search

2 open access papers mention dme-mir-1009
(2 sentences)

Stem-loop
   -- u        g c   c     u   c g 
5'   g aaguguaa a uuu uugag uac c c
     | |||||||| | ||| ||||| ||| | g
3'   c uuuacauu u aaa aacuc aug g a
   ga -        g u   -     u   a u 
Get sequence
Deep sequencing
2107 reads, 8.33 reads per million, 48 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 23993054-23993114 [-]
sense
FBtr0072201 ; CG3860-RA; intron 6
Database links

Mature sequence dme-miR-1009-3p

Accession MIMAT0005022
Previous IDsdme-miR-1009
Sequence

39 - 

ucucaaaaauuguuacauuucag

 - 61

Get sequence
Deep sequencing2082 reads, 48 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).