Stem-loop sequence dme-mir-1005

AccessionMI0005866 (change log)
DescriptionDrosophila melanogaster miR-1005 stem-loop
Gene family MIPF0000943; mir-1005
Stem-loop
   --         uc      g     ----   g 
5'   gugaguuga  gauuuc agguu    uug c
     |||||||||  |||||| |||||    ||| a
3'   cgcuuaauu  cuaagg ucuaa    agc c
   ga         -u      -     uaua   a 
Get sequence
Deep sequencing
512 reads, 0 reads per million, 45 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 4343696-4343756 [+]
sense
FBtr0112899 ; Atet-RD; intron 4
FBtr0077426 ; Atet-RA; intron 4
FBtr0077427 ; Atet-RB; intron 4
FBtr0112898 ; Atet-RC; intron 4
Database links

Mature sequence dme-miR-1005-3p

Accession MIMAT0005018
Previous IDsdme-miR-1005
Sequence

41 - 

ucuggaaucuuuaauucgcag

 - 61

Get sequence
Deep sequencing394 reads, 39 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).