Stem-loop sequence dme-mir-1004

AccessionMI0005865 (change log)
DescriptionDrosophila melanogaster miR-1004 stem-loop
Stem-loop
   -gu       cau    c c     -c  --   u 
5'    uggggga   ugau u ggaga  gg  cgg u
      |||||||   |||| | |||||  ||  ||| u
3'    acucccu   acua a ucucu  cc  guc a
   gac       -uc    c c     ua  ua   a 
Get sequence
Deep sequencing
5915 reads, 52.4 reads per million, 42 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 3767621-3767688 [+]
sense
FBtr0321309 ; CG43707-RH; intron 4
FBtr0321305 ; CG43707-RC; intron 11
FBtr0321304 ; CG43707-RD; intron 16
FBtr0321307 ; CG43707-RF; intron 16
FBtr0330223 ; CG43707-RI; intron 16
FBtr0321308 ; CG43707-RG; intron 17
FBtr0321306 ; CG43707-RE; intron 18
Database links

Mature sequence dme-miR-1004-5p

Accession MIMAT0032027
Sequence

1 - 

guugggggacauugaucucggag

 - 23

Get sequence
Deep sequencing4168 reads, 33 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-1004-3p

Accession MIMAT0005017
Previous IDsdme-miR-1004
Sequence

47 - 

ucucacaucacuucccucacag

 - 68

Get sequence
Deep sequencing1739 reads, 32 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).