Stem-loop sequence dme-mir-927

AccessionMI0005843 (change log)
DescriptionDrosophila melanogaster miR-927 stem-loop
Gene family MIPF0000452; mir-927
Literature search

4 open access papers mention dme-mir-927
(5 sentences)

Stem-loop 
   ---   uug u    a            cu       a   uggcau 
5'    ugg   c guag guuuuagaauuc  acgcuuu ccg      a
      |||   | |||| ||||||||||||  ||||||| |||       
3'    acc   g cauc caaagucuuagg  ugcgaaa ggc      c
   auu   -ua c    c            uu       c   uuaaag
Get sequence
Deep sequencing
48785 reads, 491 reads per million, 46 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 15965947-15966038 [-]
sense
FBtr0307540 ; mmd-RE; intron 2
FBtr0299535 ; mmd-RD; intron 2
FBtr0299534 ; mmd-RB; intron 2
FBtr0307541 ; mmd-RF; intron 3
FBtr0307542 ; mmd-RG; intron 3
FBtr0310306 ; mmd-RH; intron 3
FBtr0310307 ; mmd-RI; intron 3
Database links

Mature sequence dme-miR-927-5p

Accession MIMAT0005501
Previous IDsdme-miR-927
Sequence

16 -  

uuuagaauuccuacgcuuuacc

 - 37

Get sequence
Deep sequencing28043 reads, 46 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

Mature sequence dme-miR-927-3p

Accession MIMAT0020882
Sequence

56 -  

caaagcguuuggauucugaaac

 - 77

Get sequence
Deep sequencing20709 reads, 43 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).