![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dme-mir-927 |
|||||
Accession | MI0005843 (change log) | ||||
Description | Drosophila melanogaster miR-927 stem-loop | ||||
Gene family | MIPF0000452; mir-927 | ||||
Literature search |
4 open access papers mention dme-mir-927 | ||||
Stem-loop |
--- uug u a cu a uggcau 5' ugg c guag guuuuagaauuc acgcuuu ccg a ||| | |||| |||||||||||| ||||||| ||| 3' acc g cauc caaagucuuagg ugcgaaa ggc c auu -ua c c uu c uuaaag |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence dme-miR-927-5p |
|
Accession | MIMAT0005501 |
Previous IDs | dme-miR-927 |
Sequence |
16 - uuuagaauuccuacgcuuuacc - 37 |
Deep sequencing | 28043 reads, 46 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
Database links |
|
Predicted targets |
|
Mature sequence dme-miR-927-3p |
|
Accession | MIMAT0020882 |
Sequence |
56 - caaagcguuuggauucugaaac - 77 |
Deep sequencing | 20709 reads, 43 experiments |
Evidence | not experimental |
Database links |
|
References |
|
1 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
2 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|