Stem-loop sequence ame-mir-929

AccessionMI0005751 (change log)
DescriptionApis mellifera miR-929 stem-loop
Gene family MIPF0000447; mir-929
Stem-loop
   -----------a     cu       aa         g         -  ugcau 
5'             cuuaa  gggguca  uugacucua uagggaguc cc     u
               |||||  |||||||  ||||||||| ||||||||| ||      
3'             gaauu  ccucagu  gacugagau auccuucag gg     c
   aggcaacuugca     uu       cg         a         c  uauaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000066.5: 7057901-7058000 [-]
intergenic
Database links

Mature sequence ame-miR-929-5p

Accession MIMAT0004441
Sequence

17 - 

auugacucuaguagggagucc

 - 37

Get sequence
Evidence experimental; RTPCR [1], Illumina [2]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).