Stem-loop sequence ame-mir-928

AccessionMI0005749 (change log)
DescriptionApis mellifera miR-928 stem-loop
Gene family MIPF0000950; mir-928
Stem-loop
       a  -----    cu   u    aa     cgaacgucacccaguccccg 
5' gucc gu     auuc  ggc gugg  gcugg                    u
   |||| ||     ||||  ||| ||||  |||||                     
3' cagg cg     uaag  ccg cgcc  cgacc                    a
       g  uugau    -u   -    -a     auaaccagguguccauugac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000057.5: 13568496-13568595 [+]
intergenic
Database links

Mature sequence ame-miR-928-5p

Accession MIMAT0004439
Sequence

12 - 

cuggcuguggaagcuggcgaa

 - 32

Get sequence
Evidence experimental; array [1], RTPCR [1], Illumina [2]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).