![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ame-mir-375 |
|||||
Accession | MI0005740 (change log) | ||||
Description | Apis mellifera miR-375 stem-loop | ||||
Gene family | MIPF0000114; mir-375 | ||||
Literature search |
![]()
7 open access papers mention ame-mir-375 | ||||
Stem-loop |
aucgauugaauua ca u u uca c 5' ucaguuuggug ucga cc aacga acaaacuuuu a ||||||||||| |||| || ||||| |||||||||| c 3' agucaaacuau agcu gg uugcu uguuugaaag u ------guaggua ug c c --- u |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence ame-miR-375-3p |
|
Accession | MIMAT0004431 |
Sequence |
63 - uuuguucguucggcucgaguua - 84 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:17543122
"Computational and transcriptional evidence for microRNAs in the honey bee genome"
Genome Biol. 8:R97(2007).
|
2 |
PMID:22409512
"Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome"
Genes Brain Behav. 11:660-670(2012).
|