miRBase entry: ame-mir-137

Stem-loop ame-mir-137


Accession
MI0005729
Description
Apis mellifera ame-mir-137 precursor miRNA
Gene family
MIPF0000106; mir-137

Literature search
2 open access papers mention ame-mir-137
(3 sentences)

Sequence

gacuucauaggccagguuggcgacgcguauucuuggggaauuaacacacauuugcgcugUUAUUGCUUGAGAAUACACGUAguuugccuggucguucacu
.........((((((((.(((.(((.(((((((((((.(((.(((((.(....).).))))))).))))))))))).))).))).)))))))).......

Structure
gacuucaua        u   g   c           g   u    - a a 
         ggccaggu ggc acg guauucuuggg aau aaca c c u
         |||||||| ||| ||| ||||||||||| ||| |||| | |  
         cugguccg uug UGC CAUAAGAGUUC UUA UUgu g g u
--ucacuug        u   A   A           G   -    c c u 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
Weaver et al. identify a second variant mature miRNA sequence offset including an extra 2 nt (UG) at the 5' end, and 3 nt at the 3' end (GUU) [1]

Genome context
CM000065.5: 5447771-5447870 [-]

Database links

Mature ame-miR-137-3p

Accession MIMAT0004421
Description Apis mellifera ame-miR-137-3p mature miRNA
Sequence 60 - UUAUUGCUUGAGAAUACACGUA - 81
Evidence experimental
RTPCR [1], Illumina [2-3]

References

  1. PubMed ID: 17543122
    Computational and transcriptional evidence for microRNAs in the honey bee genome
    Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG
    Genome Biol (2007) 8:R97

  2. PubMed ID: 22409512
    Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome
    "Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y"
    "Genes Brain Behav (2012) 11:660-670

  3. PubMed ID: 26853694
    MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)
    "Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL"
    "Insect Mol Biol (2016) 25:216-226