Stem-loop sequence ame-mir-137

AccessionMI0005729 (change log)
DescriptionApis mellifera miR-137 stem-loop
Gene family MIPF0000106; mir-137
Literature search

2 open access papers mention ame-mir-137
(3 sentences)

Stem-loop 
   gacuucaua        ug  g   c       ug  g   u    - a a 
5'          ggccaggu  gc acg guauucu  gg aau aaca c c u
            ||||||||  || ||| |||||||  || ||| |||| | |  
3'          cugguccg  ug ugc cauaaga  uc uua uugu g g u
   --ucacuug        uu  a   a       gu  g   -    c c u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Weaver et al. identify a second variant mature miRNA sequence offset including an extra 2 nt (UG) at the 5' end, and 3 nt at the 3' end (GUU) [1]

Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000065.5: 5447771-5447870 [-]
intergenic
Database links

Mature sequence ame-miR-137-3p

Accession MIMAT0004421
Sequence

60 -  

uuauugcuugagaauacacgua

 - 81

Get sequence
Evidence experimental; RTPCR [1], Illumina [2-3]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).