Stem-loop sequence ppt-MIR156b

AccessionMI0005696 (change log)
DescriptionPhyscomitrella patens miR156b stem-loop
Gene family MIPF0000008; MIR156
Literature search

5 open access papers mention ppt-MIR156b
(10 sentences)

Stem-loop
   ------------------------------------------gugaggcucgagugcagacacuauucaagugugggcggggggagcggga      -                g   c  cu     ag 
5'                                                                                            gugaca gaagagagugagcacg uug gc  guacg  g
                                                                                              |||||| |||||||||||||||| ||| ||  |||||  a
3'                                                                                            cgcugu cuucucucacucgugu aac cg  caugc  u
   guggugugggaaguggaggggaggaggagggaguguguggggggaggggugggagaguaguguuuacugcaguguugcugcucccucuccg      a                g   u  uu     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr21: 9338002-9338221 [-]
intergenic
Database links

Mature sequence ppt-miR156b

Accession MIMAT0004384
Sequence

51 - 

ugacagaagagagugagcac

 - 70

Get sequence
Evidence experimental; cloned [1], 454 [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).