Stem-loop sequence ppt-MIR904b

AccessionMI0005693 (change log)
DescriptionPhyscomitrella patens miR904b stem-loop
Gene family MIPF0000379; MIR904
Literature search

2 open access papers mention ppt-MIR904b
(4 sentences)

Stem-loop
   -----------cuuuggagcgaugugugucaugaugg    ----auu     a       ac                     caa   u   a   u      ucc  gg     gcu 
5'                                      cggu       uugug ugcuaau  ggucuugucaauguuuagggg   agg gca cua gcaaca   cu  ugcga   c
                                        ||||       ||||| |||||||  |||||||||||||||||||||   ||| ||| ||| ||||||   ||  |||||    
3'                                      gcca       aacac gcgguua  ccagaacgguuguaaaucccc   ucc cgu gau cguugu   ga  gcgcu   u
   aguguuaacacagaaaacugaagacgacuaggucgca    ggguuac     -       au                     acc   -   -   -      ---  au     agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (v3.0) Overlapping transcripts
Chr22: 2033169-2033388 [+]
intergenic
Database links

Mature sequence ppt-miR904b

Accession MIMAT0004380
Sequence

51 - 

ucuugucaauguuuaggggca

 - 71

Get sequence
Evidence experimental; cloned [1], 454 [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).