Stem-loop sequence ppt-MIR904a

AccessionMI0005692 (change log)
DescriptionPhyscomitrella patens miR904a stem-loop
Gene family MIPF0000379; MIR904
Literature search

2 open access papers mention ppt-MIR904a
(4 sentences)

Stem-loop
   ---------------uguuggaguuccu     g g u   ---g    au     au      au           u         caa     u   uau     ugcuug        u 
5'                             ucggu u g guu    caau  uugug  gcuaau  ggucuugucaa guuuagggg   aggcc gau   gcaga      guguaagc u
                               ||||| | | |||    ||||  |||||  ||||||  ||||||||||| |||||||||   ||||| |||   |||||      ||||||||  
3'                             ggcca g c cag    guua  aacac  cgauua  ccagaacgguu uaaaucccc   uccgg uua   cguuu      cauguucg a
   aggacgaacucgagcaugacuaaucagc     g g -   uuaa    -c     -c      au           c         acc     -   --u     --ucaa        u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (v3.0) Overlapping transcripts
Chr19: 4384251-4384470 [-]
intergenic
Database links

Mature sequence ppt-miR904a

Accession MIMAT0004379
Sequence

51 - 

ucuugucaauguuuaggggca

 - 71

Get sequence
Evidence experimental; cloned [1], 454 [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).