Stem-loop sequence ppt-MIR536b

AccessionMI0005691 (change log)
DescriptionPhyscomitrella patens miR536b stem-loop
Gene family MIPF0000398; MIR536
Literature search

2 open access papers mention ppt-MIR536b
(16 sentences)

Stem-loop
   gucggcaguuuucguauuucgccgacuucggugacugcagaaagucgaaac     a      g   aa     -     agacuugucuggcaucauuugguagucgucaaacuuauu 
5'                                                    aguag gagccu uug  uugca gcggu                                       c
                                                      ||||| |||||| |||  ||||| |||||                                       u
3'                                                    ucauu uuuggg aac  aacgu ugucg                                       c
   -----------------acgaccaucccugcgaggaggguacaccuagaau     g      g   -c     g     aaccgugcuuaaagaccauaguaaggcgauguugagccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr23: 2550169-2550390 [-]
intergenic
Database links

Mature sequence ppt-miR536b

Accession MIMAT0004378
Sequence

151 - 

uucgugccaagcugugugcaac

 - 172

Get sequence
Evidence experimental; cloned [1], 454 [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).