Stem-loop sequence ppt-MIR171b

AccessionMI0005689 (change log)
DescriptionPhyscomitrella patens miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

1 open access papers mention ppt-MIR171b
(1 sentences)

Stem-loop
   -   c     u      -  cc        a  u u uuuu     a 
5'  agg augug uauugg gc  gcucaauc ga g c    ccagc a
    ||| ||||| |||||| ||  |||||||| || | |    |||||  
3'  ucc uacac auaacc cg  cgaguuag cu c g    ggucg c
   u   -     u      g  -c        a  c u uuau     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr18: 5847812-5847903 [-]
intergenic
Database links

Mature sequence ppt-miR171b

Accession MIMAT0004376
Sequence

67 - 

uugagccgcgccaauaucaca

 - 87

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).