Stem-loop sequence ppt-MIR171a

AccessionMI0005688 (change log)
DescriptionPhyscomitrella patens miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

1 open access papers mention ppt-MIR171a
(1 sentences)

Stem-loop
   -   c              - c        a    a c     u u 
5'  agg augugauauuggug g gcucaauc gaug c augcc g g
    ||| |||||||||||||| | |||||||| |||| | ||||| | a
3'  ucc uacacuauaaccgc c cgaguuag cuac g ugcgg c u
   u   -              g -        a    c u     u g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (v3.0) Overlapping transcripts
Chr22: 9196827-9196917 [-]
intergenic
Database links

Mature sequence ppt-miR171a

Accession MIMAT0004375
Sequence

67 - 

ugagccgcgccaauaucacau

 - 87

Get sequence
Evidence experimental; cloned [1], 454 [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).