Stem-loop sequence ppt-MIR536c

AccessionMI0005687 (change log)
DescriptionPhyscomitrella patens miR536c stem-loop
Literature search

2 open access papers mention ppt-MIR536c
(16 sentences)

Stem-loop
   -------------------------      --        c  uu      ag c  -   u           a         ug     ua   uaaaacagagagaugaugcaauugguaugu 
5'                          uuguuc  gaccauug ag  gcuuuu  a gc caa gcuuggcauga ugucuugag  ucugg  gcc                              g
                            ||||||  |||||||| ||  ||||||  | || ||| ||||||||||| |||||||||  |||||  |||                              g
3'                          agcagg  uugguaau uc  cgagaa  u cg guu cgaaccgugcu acagagcuu  ggacc  cgg                              a
   cuacaaucucuaggucaucuugggu      uu        -  --      cu u  u   u           a         --     uc   ucgcuugcuaaggagauuuuggucucuucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr03: 12087772-12087993 [-]
intergenic
Database links

Mature sequence ppt-miR536c

Accession MIMAT0004374
Sequence

151 - 

aucgugccaagcuuugugcuuu

 - 172

Get sequence
Evidence experimental; cloned [1], 454 [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).