Stem-loop sequence ppt-MIR902b

AccessionMI0005686 (change log)
DescriptionPhyscomitrella patens miR902b stem-loop
Gene family MIPF0000376; MIR902
Literature search

2 open access papers mention ppt-MIR902b
(2 sentences)

Stem-loop
   gguugugauaaaucgguuccgugucgucauaaucgcaaguguugcaggcaguuaugaggagauggagagcgugcagacuu    c        a c             u    a      -   -      u 
5'                                                                                 guuu cuuccucu g cuaugaugcagau cuuc ucuguu ugu uaucgu c
                                                                                   |||| |||||||| | ||||||||||||| |||| |||||| ||| ||||||  
3'                                                                                 uaaa gaaggaga c gauacuacgucug gaag agacaa aca guggua u
   ------------------------------------------uuuuaacgcacguccgguuuaagcucgguccauaauuc    c        a c             -    c      u   u      c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr07: 11978379-11978601 [+]
intergenic
Database links

Mature sequence ppt-miR902b-5p

Accession MIMAT0004963
Sequence

98 - 

uaugaugcagauucuucaucu

 - 118

Get sequence
Evidence experimental; 454 [2]

Mature sequence ppt-miR902b-3p

Accession MIMAT0004373
Previous IDsppt-miR902b
Sequence

151 - 

acgaaggucugcaucauagc

 - 170

Get sequence
Evidence experimental; cloned [1], 454 [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).