Stem-loop sequence ppt-MIR902a

AccessionMI0005685 (change log)
DescriptionPhyscomitrella patens miR902a stem-loop
Gene family MIPF0000376; MIR902
Literature search

2 open access papers mention ppt-MIR902a
(2 sentences)

Stem-loop
   gcucgugacccucugaagggaacuuuggccugagaagagcgugggauuguaggaacaugaguggaucuacagcauuugagauuauucauuugcauc    acga            u    ac    gug     c 
5'                                                                                                 cgcu    uaugaugcagau cuuc  cugu   auacu u
                                                                                                   ||||    |||||||||||| ||||  ||||   ||||| u
3'                                                                                                 gcga    auacuacgucug gaag  gaca   uaugg g
   -------------------------------------------------uacguggaguuaauucguagaucacaacuuacguggucuaaaugcaa    accg            -    ca    --a     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr01: 4392280-4392502 [+]
intergenic
Database links

Mature sequence ppt-miR902a-5p

Accession MIMAT0004962
Sequence

105 - 

uaugaugcagauucuuca

 - 122

Get sequence
Evidence experimental; 454 [2]

Mature sequence ppt-miR902a-3p

Accession MIMAT0004372
Previous IDsppt-miR902a
Sequence

151 - 

acgaaggucugcaucauagc

 - 170

Get sequence
Evidence experimental; cloned [1], 454 [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).