Stem-loop sequence ppt-MIR477g

AccessionMI0005674 (change log)
Previous IDsppt-MIR477b
DescriptionPhyscomitrella patens miR477g stem-loop
Gene family MIPF0000216; MIR477
Literature search

1 open access papers mention ppt-MIR477g
(11 sentences)

Stem-loop
   gu    g   u      u a             a   --uc     u  c  uga        uu 
5'   guuc uuu ucuccc c aaggcuuccaaca cag    ggaau aa uc   ugcggcca  a
     |||| ||| |||||| | ||||||||||||| |||    ||||| || ||   ||||||||  u
3'   caag aag agaggg g uuccgaagguugu guc    ucuua uu ag   acguuggu  c
   -c    a   c      u c             c   uuga     -  a  -ug        ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Talmor-Neiman et al. reported a mature miRNA derived from the 3' arm of this hairpin, and named it miR1213 [1]. A mature miRNA from the 5' arm was named miR477b [2]. Names of the miR477 family are rationalised in [3]. The mature sequences shown here are the most abundant clones by deep-sequencing [3].

Genome context
Coordinates (v3.0) Overlapping transcripts
Chr22: 2647177-2647304 [-]
intergenic
Database links

Mature sequence ppt-miR477g-5p

Accession MIMAT0004362
Previous IDsppt-miR477b
Sequence

14 - 

ucccucaaaggcuuccaacaa

 - 34

Get sequence
Evidence experimental; Northern [2], 454 [3], cloned [3]

Mature sequence ppt-miR477g-3p

Accession MIMAT0003902
Previous IDsppt-miR1213
Sequence

98 - 

guuggaagccuucgugggaga

 - 118

Get sequence
Evidence experimental; Northern [1], cloned [2], 454 [3]

References

1
PMID:16824179 "Novel micro-RNAs and intermediates of micro-RNA biogenesis from moss" Talmor-Neiman M, Stav R, Frank W, Voss B, Arazi T Plant J. 47:25-37(2006).
2
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
3
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).