Stem-loop sequence ppt-MIR477f

AccessionMI0005673 (change log)
Previous IDsppt-MIR477a
DescriptionPhyscomitrella patens miR477f stem-loop
Gene family MIPF0000216; MIR477
Literature search

1 open access papers mention ppt-MIR477f
(11 sentences)

Stem-loop
   gu    g   u        a         a   a   -      ----   a   c       uu 
5'   guuu uuu ucucccuc aaggcuucc aca cag gagggu    aca uuc auugugg  a
     |||| ||| |||||||| ||||||||| ||| ||| ||||||    ||| ||| |||||||  u
3'   uaag aag agagggag uuccgaagg ugu guc cucucg    ugu gag ugauacc  a
   -u    a   u        c         c   c   u      uuuu   g   u       ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was named miR477a in [1]. The miR477 family contains miRNAs previously called miR473, miR1210 and miR1213 here. The names and sequences are rationalised in [2]. The mature sequence shown here is the most abundant clone by deep-sequencing [2].

Genome context
Coordinates (v3.0) Overlapping transcripts
Chr19: 4222086-4222212 [-]
intergenic
Database links

Mature sequence ppt-miR477f

Accession MIMAT0004361
Previous IDsppt-miR477a
Sequence

14 - 

ucccucaaaggcuuccaacaa

 - 34

Get sequence
Evidence experimental; Northern [1], 454 [2], cloned [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).