Stem-loop sequence ppt-MIR477a

AccessionMI0005672 (change log)
Previous IDsppt-MIR473b
DescriptionPhyscomitrella patens miR477a stem-loop
Gene family MIPF0000216; MIR477
Literature search

1 open access papers mention ppt-MIR477a
(11 sentences)

Stem-loop
   gu  c             u          c   -a  a  u  g 
5'   ug uuuuuccucuccc caaaggcuuc aac  ug ug gc u
     || ||||||||||||| |||||||||| |||  || || ||  
3'   ac aagaaggagaggg guuuccgaag uug  ac ac cg a
   --  a             u          a   ca  -  -  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Talmor-Neiman et al. reported a mature miRNA derived from the 3' arm of this hairpin, and named it miR1210 [1]. A mature miRNA from the 5' arm was named miR473b [2]. This sequence was later determined to be a member of the miR477 family [3], and is therefore renamed here. The mature sequences shown here are the most abundant clones by deep-sequencing [3].

Genome context
Coordinates (v3.0) Overlapping transcripts
Chr16: 1480854-1480938 [-]
intergenic
Database links

Mature sequence ppt-miR477a-5p

Accession MIMAT0004360
Previous IDsppt-miR473b
Sequence

12 - 

cucucccucaaaggcuucca

 - 31

Get sequence
Evidence experimental; Northern [2], 454 [3], cloned [3]

Mature sequence ppt-miR477a-3p

Accession MIMAT0003899
Previous IDsppt-miR1210
Sequence

58 - 

agaagccuuugugggagagga

 - 78

Get sequence
Evidence experimental; Northern [1], 454 [3]

References

1
PMID:16824179 "Novel micro-RNAs and intermediates of micro-RNA biogenesis from moss" Talmor-Neiman M, Stav R, Frank W, Voss B, Arazi T Plant J. 47:25-37(2006).
2
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
3
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).