Stem-loop sequence ppt-MIR477c

AccessionMI0005671 (change log)
Previous IDsppt-MIR473a
DescriptionPhyscomitrella patens miR477c stem-loop
Gene family MIPF0000216; MIR477
Literature search

1 open access papers mention ppt-MIR477c
(11 sentences)

Stem-loop
   gu  a          c cu            a   c   uuu 
5'   ug uuuuuccucu c  caaaggcuucca cgu cuu   g
     || |||||||||| |  |||||||||||| ||| |||   u
3'   ac aaggaggaga g  guuucugaaggu gca gaa   g
   --  a          a uu            c   c   cga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was named miR473a in [1]. The miR477 family contains miRNAs previously called miR473, miR1210 and miR1213 here. The names and sequences are rationalised in [2]. The mature sequence shown here is the most abundant clone by deep-sequencing [2].

Genome context
Coordinates (v3.0) Overlapping transcripts
Chr25: 5057729-5057813 [-]
intergenic
Database links

Mature sequence ppt-miR477c

Accession MIMAT0004359
Previous IDsppt-miR473a
Sequence

12 - 

cucucccucaaaggcuucca

 - 31

Get sequence
Evidence experimental; Northern [1], 454 [2], cloned [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).