Stem-loop sequence ppt-MIR419

AccessionMI0005670 (change log)
DescriptionPhyscomitrella patens miR419 stem-loop
Literature search

1 open access papers mention ppt-MIR419
(1 sentences)

Stem-loop
   -   -u       -uua     a    uaaccgua    ca gu 
5'  ggu  gccugug    guuau guuc        aguc  c  c
    |||  |||||||    ||||| ||||        ||||  |   
3'  cua  cggauau    cagua uaag        ucgg  g  g
   u   uc       guag     g    -----uag    ag ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context
Coordinates (v3.0) Overlapping transcripts
Chr06: 8028394-8028475 [-]
intergenic
Database links

Mature sequence ppt-miR419

Accession MIMAT0004358
Sequence

52 - 

ugaugaaugaugacgauguau

 - 72

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).