Stem-loop sequence ppt-MIR414

AccessionMI0005669 (change log)
DescriptionPhyscomitrella patens miR414 stem-loop
Gene family MIPF0000375; MIR414
Literature search

1 open access papers mention ppt-MIR414
(2 sentences)

Stem-loop
   ----------------------------a    uuc    -acaauua    a   caaugcuagaauguggggcucaccagauuuuccaacugcauuggcua 
5'                              gacg   aaga        gaga gac                                               g
                                ||||   ||||        |||| |||                                                
3'                              cugc   uucu        uucu cug                                               c
   gacuacgacuccugcuccuacuacuccua    ---    acuacugc    a   cuacuacuucuacuguuucuauaccaaugacgguuucgcgaucgucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context
Coordinates (v3.0) Overlapping transcripts
Chr11: 12877706-12877881 [+]
intergenic
Database links

Mature sequence ppt-miR414

Accession MIMAT0004357
Sequence

146 - 

ucauccucaucauccucgucc

 - 166

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).