Stem-loop sequence ppt-MIR408a

AccessionMI0005668 (change log)
Previous IDsppt-MIR408
DescriptionPhyscomitrella patens miR408 stem-loop
Literature search

1 open access papers mention ppt-MIR408a
(4 sentences)

Stem-loop
   acaaccag     ca    a   uc      cca        gauu        ccgaa    au   acca    gagau   ac 
5'         cacug  cugc ucu  ccugug   ucuucguc    gucucgua     agug  uca    cagc     cag  u
           |||||  |||| |||  ||||||   ||||||||    ||||||||     ||||  |||    ||||     |||   
3'         gugac  gacg gga  ggauac   agaaguag    uagagcau     ucac  agu    gucg     guc  c
   --------     -c    -   -c      ---        ----        ---ag    --   ---a    aaauu   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr03: 17195194-17195341 [+]
intergenic
Database links

Mature sequence ppt-miR408a

Accession MIMAT0004356
Previous IDsppt-miR408
Sequence

11 - 

cugcacugcaucuucccugugc

 - 32

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).