Stem-loop sequence ppt-MIR395

AccessionMI0005667 (change log)
DescriptionPhyscomitrella patens miR395 stem-loop
Literature search

1 open access papers mention ppt-MIR395
(1 sentences)

Stem-loop
   -aauu   aaa        ----      auauucuagucguugguuuauggugccuaagaaaaauggaucguuauguuuuauucaagaua 
5'      uug   ccuucuuu    ugcuuc                                                              u
        |||   ||||||||    ||||||                                                              a
3'      aac   ggaagggg    gcgaag                                                              c
   uauuu   --g        guuu      ucguuugaguagauaauuucuaggauauggacguaaagaauaucaaugauguaaguaaccga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature miRNA sequence reported in [1] has a 1-nt insertion with respect to the genome assembly sequence shown here.

Genome context
Coordinates (v3.0) Overlapping transcripts
Chr12: 8343462-8343639 [+]
intergenic
Database links

Mature sequence ppt-miR395

Accession MIMAT0004355
Sequence

150 - 

cugaagcguuugggggaagg

 - 169

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).