Stem-loop sequence ppt-MIR166a

AccessionMI0005660 (change log)
DescriptionPhyscomitrella patens miR166a stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention ppt-MIR166a
(5 sentences)

Stem-loop
   uc     u a      ccc     c       ---c    gccu uu    u 
5'   ugcug g ggaaug   ccugg ccgaagc    augu    u  caug c
     ||||| | ||||||   ||||| |||||||    ||||    |  ||||  
3'   acgac c ccuuac   ggacc ggcuucg    uaca    g  gugc c
   ac     u c      uuc     a       aaau    -aau gg    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr02: 9952562-9952663 [-]
intergenic
Database links

Mature sequence ppt-miR166a

Accession MIMAT0004352
Sequence

74 - 

ucggaccaggcuucauucccc

 - 94

Get sequence
Evidence experimental; 454 [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).