Stem-loop sequence ppt-MIR166b

AccessionMI0005659 (change log)
DescriptionPhyscomitrella patens miR166b stem-loop
Gene family MIPF0000004; MIR166
Literature search

3 open access papers mention ppt-MIR166b
(7 sentences)

Stem-loop
     u     u a      cc  a   a       cau   c    c   uag 
5' cu uguug g ggaaug  gc ugg ccgaagc   gcg ucca auc   a
   || ||||| | ||||||  || ||| |||||||   ||| |||| |||    
3' ga acgac c ccuuac  cg acc ggcuucg   cgc aggu uag   c
     c     u c      uu  g   a       uau   -    u   ugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (v3.0) Overlapping transcripts
Chr17: 3693215-3693317 [-]
intergenic
Database links

Mature sequence ppt-miR166b

Accession MIMAT0004351
Sequence

74 - 

ucggaccaggcuucauucccc

 - 94

Get sequence
Evidence experimental; 454 [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).