Stem-loop sequence ppt-MIR160d

AccessionMI0005658 (change log)
DescriptionPhyscomitrella patens miR160d stem-loop
Gene family MIPF0000032; MIR160
Literature search

3 open access papers mention ppt-MIR160d
(9 sentences)

Stem-loop
   aug ug  -  c  c         g       c        g  -    ag 
5'    u  ga uc gc uggcucccu caugccg cugugaau cu guga  a
      |  || || || ||||||||| ||||||| |||||||| || ||||   
3'    a  cu ag cg accgaggga gugcggu gauacuua ga cauu  g
   --a gu  c  a  a         g       c        a  u    ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr21: 10139128-10139227 [+]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR160d
ppt-MIR160hChr21: 10138798-10138933 [+]
ppt-MIR160dChr21: 10139128-10139227 [+]
ppt-MIR160iChr21: 10139826-10139964 [+]
Database links

Mature sequence ppt-miR160d

Accession MIMAT0004350
Sequence

11 - 

cgccuggcucccugcaugccg

 - 31

Get sequence
Evidence experimental; 454 [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).