Stem-loop sequence ppt-MIR160c

AccessionMI0005657 (change log)
DescriptionPhyscomitrella patens miR160c stem-loop
Gene family MIPF0000032; MIR160
Literature search

3 open access papers mention ppt-MIR160c
(9 sentences)

Stem-loop
   auau   a  c c         ug       -  ugc        c   a 
5'     ugg uc g cuggcuccc  caugcca cu   gaaucuug caa c
       ||| || | |||||||||  ||||||| ||   |||||||| ||| g
3'     acc gg c gacuggggg  gugcggu gg   cuuggggc guu u
   acau   -  a a         gu       c  -ua        u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr18: 6744327-6744426 [-]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR160c
ppt-MIR160bChr18: 6744966-6745068 [-]
ppt-MIR160cChr18: 6744327-6744426 [-]
Database links

Mature sequence ppt-miR160c

Accession MIMAT0004349
Sequence

11 - 

cgccuggcucccugcaugcca

 - 31

Get sequence
Evidence experimental; 454 [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).