Stem-loop sequence ppt-MIR160b

AccessionMI0005656 (change log)
DescriptionPhyscomitrella patens miR160b stem-loop
Gene family MIPF0000032; MIR160
Literature search

3 open access papers mention ppt-MIR160b
(9 sentences)

Stem-loop
   au  u  a  c  c          u      a   c  gc uu c     a 
5'   gc ag uc gc uggcucccug augcca cug ga  c  g uaaau u
     || || || || |||||||||| |||||| ||| ||  |  | |||||  
3'   cg uc ag cg acugagggac ugcggu gau cu  g  c guuug u
   -g  u  c  a  a          u      c   a  ua uu c     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr18: 6744966-6745068 [-]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR160b
ppt-MIR160bChr18: 6744966-6745068 [-]
ppt-MIR160cChr18: 6744327-6744426 [-]
Database links

Mature sequence ppt-miR160b

Accession MIMAT0004348
Sequence

11 - 

cgccuggcucccuguaugcca

 - 31

Get sequence
Evidence not experimental

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).