Stem-loop sequence ppt-MIR160a

AccessionMI0005655 (change log)
DescriptionPhyscomitrella patens miR160a stem-loop
Gene family MIPF0000032; MIR160
Literature search

4 open access papers mention ppt-MIR160a
(11 sentences)

Stem-loop
   -    u gaa   c           u      c   c g      c   a 
5'  ggag g   cug cuggcucccug augcca cug g ggcuug caa g
    |||| |   ||| ||||||||||| |||||| ||| | |||||| ||| u
3'  ccuc c   gac gaccgagggac uacggu gau c ucgagc guu g
   u    - --a   a           c      c   a g      u   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr15: 9258342-9258440 [+]
intergenic
Database links

Mature sequence ppt-miR160a

Accession MIMAT0004347
Sequence

11 - 

ugccuggcucccuguaugcca

 - 31

Get sequence
Evidence experimental; 454 [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).