Stem-loop sequence ppt-MIR156c

AccessionMI0005654 (change log)
DescriptionPhyscomitrella patens miR156c stem-loop
Gene family MIPF0000008; MIR156
Literature search

5 open access papers mention ppt-MIR156c
(10 sentences)

Stem-loop
      u   a      -                g  g    u     ag 
5' gag ggg gugaca gaagagagugagcaca uu agca guacg  g
   ||| ||| |||||| |||||||||||||||| || |||| |||||  g
3' cuc ucc cacugu cuucucucacucgugu aa ucgu caugc  u
      -   g      a                g  g    u     ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr18: 10522192-10522286 [-]
intergenic
Database links

Mature sequence ppt-miR156c

Accession MIMAT0004346
Sequence

10 - 

ugacagaagagagugagcac

 - 29

Get sequence
Evidence experimental; cloned [1], 454 [2]

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).