Dead miRNA entry

miRNA accession:
MI0005637
miRNA ID:
mtr-MIR169o
Forward to:
MI0005623
Comment:
The mtr-MIR169 entries in miRBase 19 map to only 11 loci in the MT3.5.2 genome assembly. The entries have therefore been rationalised and merged in miRBase 20, and some loci renamed.

Previous miRNA entry

Stem-loop sequence mtr-MIR169o

AccessionMI0005637 (change log)
DescriptionMedicago truncatula miR169o stem-loop
Stem-loop
   -    u        a  ug   u       -u  --u    gaaaa 
5'  agau ugagccaa ga  acu gccggca  gc   gccu     g
    |||| |||||||| ||  ||| |||||||  ||   ||||      
3'  uuug acuugguu cu  uga cggucgu  ug   uggg     c
   g    u        a  gu   -       uu  uug    aagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mtr-miR169o

Accession MIMAT0011123
Sequence

6 - 

uugagccaaagaugacuugcc

 - 26

Get sequence
Evidence experimental;