Dead miRNA entry

miRNA accession:
MI0005633
miRNA ID:
mtr-MIR395r
Forward to:
MI0005079
Comment:
Some of the MIR395 sequences in miRBase 19 map to the same locus in the Mt3.5.2 genome assembly. The entries are rationalised and merged in miRBase 20.

Previous miRNA entry

Stem-loop sequence mtr-MIR395r

AccessionMI0005633 (change log)
DescriptionMedicago truncatula miR395r stem-loop
Stem-loop
      u          ug          gcau      au      ----auu   u u 
5' ucu agaguuccuu  aacgcuucau    gagaau  cuaucu       ugg c a
   ||| ||||||||||  ||||||||||    ||||||  ||||||       ||| |  
3' agg ucucaagggg  uugugaagua    uuuuua  gauaga       acc g a
      u          gu          -acu      cc      aaagauu   u a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mtr-miR395r

Accession MIMAT0011119
Sequence

86 - 

aaugaaguguuugggggaacu

 - 106

Get sequence
Evidence experimental;