Dead miRNA entry

miRNA accession:
MI0005632
miRNA ID:
mtr-MIR169k
Forward to:
MI0005577
Comment:
The mtr-MIR169 entries in miRBase 19 map to only 11 loci in the MT3.5.2 genome assembly. The entries have therefore been rationalised and merged in miRBase 20, and some loci renamed.

Previous miRNA entry

Stem-loop sequence mtr-MIR169k

AccessionMI0005632 (change log)
DescriptionMedicago truncatula miR169k stem-loop
Stem-loop
   g    c         ug           g  --  --a     a 
5'  aaug agccaaggg  auuugccggca au  au   uauga u
    |||| |||||||||  ||||||||||| ||  ||   |||||  
3'  uuac ucgguucuc  ugaacggcugu ua  ua   auacu a
   -    a         cu           g  cg  gag     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 44368729-44368828 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR169k
mtr-MIR169hchr4: 44360866-44360951 [-]
mtr-MIR169ichr4: 44366823-44366908 [-]
mtr-MIR169kchr4: 44368729-44368828 [+]
mtr-MIR169bchr4: 44375579-44375655 [-]
Database links

Mature sequence mtr-miR169k

Accession MIMAT0011118
Sequence

6 - 

gcagccaagggugauuugccg

 - 26

Get sequence
Evidence experimental;