Dead miRNA entry

miRNA accession:
MI0005631
miRNA ID:
mtr-MIR169l
Forward to:
MI0005578
Comment:
The mtr-MIR169 entries in miRBase 19 map to only 11 loci in the MT3.5.2 genome assembly. The entries have therefore been rationalised and merged in miRBase 20, and some loci renamed.

Previous miRNA entry

Stem-loop sequence mtr-MIR169l

AccessionMI0005631 (change log)
DescriptionMedicago truncatula miR169l stem-loop
Stem-loop
   agaugaagccaaggaugacuugccgguauaauaguaauuugccacaaaucuagauagcuauua  u          g            aa  a        --c g             u   -u   uua 
5'                                                                gc auguuuggau ggcggugagauu  ca aauuacag   a cauugugauuuug uga  gcu   a
                                                                  || |||||||||| ||||||||||||  || ||||||||   | ||||||||||||| |||  |||   a
3'                                                                cg uauaaaucua cugccacucuaa  gu uuaauguc   u gugacauuaaaac auu  uga   g
   -----------------------uuauaucggcuuccuacuggacggccuuuacuuugauuua  -          a            ga  a        acu g             u   uu   ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 10204628-10204760 [+]
intergenic
Database links

Mature sequence mtr-miR169l

Accession MIMAT0011117
Sequence

6 - 

gaagccaaggaugacuugccg

 - 26

Get sequence
Evidence experimental;