Dead miRNA entry

miRNA accession:
MI0005624
miRNA ID:
mtr-MIR169i
Forward to:
MI0005623
Comment:
The mtr-MIR169 entries in miRBase 19 map to only 11 loci in the MT3.5.2 genome assembly. The entries have therefore been rationalised and merged in miRBase 20, and some loci renamed.

Previous miRNA entry

Stem-loop sequence mtr-MIR169i

AccessionMI0005624 (change log)
DescriptionMedicago truncatula miR169i stem-loop
Stem-loop
   -    u        a  ug   u       -u  --u    gaaaa 
5'  agau ugagccaa ga  acu gccggca  gc   gccu     g
    |||| |||||||| ||  ||| |||||||  ||   ||||      
3'  uuug acuugguu cu  uga cggucgu  ug   uggg     c
   g    u        a  gu   -       uu  uug    aagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 44366823-44366908 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR169i
mtr-MIR169bchr4: 44375579-44375655 [-]
mtr-MIR169kchr4: 44368729-44368828 [+]
mtr-MIR169ichr4: 44366823-44366908 [-]
mtr-MIR169hchr4: 44360866-44360951 [-]
Database links

Mature sequence mtr-miR169i

Accession MIMAT0011110
Sequence

6 - 

uugagccaaagaugacuugcc

 - 26

Get sequence
Evidence experimental;